Quick Start¶
Get started with MucOneUp in under 5 minutes. This tutorial walks through a complete workflow from simulation to analysis.
Prerequisites¶
- MucOneUp installed (Installation Guide)
- Configuration file (
config.jsonin repository root)
Getting Help¶
View help and version information without providing a config file:
muconeup -h # Show help
muconeup -V # Show version
muconeup simulate --help # Show command-specific help
Your First Simulation¶
Generate a diploid haplotype with fixed VNTR length:
# Create output directory
mkdir -p output
# Run simulation
muconeup --config config.json simulate \
--fixed-lengths 60 \
--out-base output/my_first_simulation
What happened?
MucOneUp generated a diploid reference with two haplotypes, each containing exactly 60 VNTR repeats.
Output files:
View the Output¶
# Check file size
ls -lh output/my_first_simulation.001.simulated.fa
# View FASTA headers
grep ">" output/my_first_simulation.001.simulated.fa
# >haplotype_1 length=60_repeats assembly=hg38
# >haplotype_2 length=60_repeats assembly=hg38
# Count sequences
grep -c ">" output/my_first_simulation.001.simulated.fa
# 2 (diploid: two haplotypes)
Add Structure Output¶
Generate repeat structure files to see the VNTR composition:
muconeup --config config.json simulate \
--fixed-lengths 60 \
--output-structure \
--out-base output/with_structure
Output files:
View the Structure¶
Example output:
# Generated: 2025-10-20 14:45:32
# Configuration: config.json
# VNTR Length: 60 repeats
haplotype_1 1-2-3-4-5-C-X-A-B-X-X-A-B-6-7-8-9
haplotype_2 1-2-3-4-5-C-X-B-X-A-X-B-A-6p-7-8-9
Understanding the structure:
- Dash-separated symbols represent repeat units
- Terminal block (6/6p → 7 → 8 → 9) is always present
- Symbols defined in
config.json(1, 2, 3, X, A, B, C, 6, 6p, 7, 8, 9)
Apply a Mutation¶
Generate normal and mutated pairs to benchmark variant callers:
muconeup --config config.json simulate \
--mutation-name normal,dupC \
--mutation-targets 1,25 \
--output-structure \
--out-base output/mutation_example
What happened?
- Generated two complete simulations: normal and dupC mutated
- Applied dupC mutation at haplotype 1, repeat position 25
- Created structure files showing mutation markers
Output files:
output/
├── mutation_example.001.normal.fa
├── mutation_example.001.normal.vntr_structure.txt
├── mutation_example.001.normal.simulation_stats.json
├── mutation_example.001.mut.fa
├── mutation_example.001.mut.vntr_structure.txt
└── mutation_example.001.mut.simulation_stats.json
View the Mutation¶
Example output:
# Mutation Applied: dupC (Targets: [(1, 25)])
haplotype_1 1-2-3-4-5-C-X-A-B-X-X-A-B-Xm-A-6-7-8-9
haplotype_2 1-2-3-4-5-C-X-B-X-A-X-B-A-6p-7-8-9
Note the Xm marker showing the mutated repeat position.
Check Ground Truth¶
# View mutation details in JSON
jq '.mutations' output/mutation_example.001.mut.simulation_stats.json
Example output:
{
"mutation_name": "dupC",
"targets": [[1, 25]],
"mutated_positions": {
"haplotype_1": [25]
},
"mutated_units": {
"haplotype_1": {
"25": "GCCCCACCCCTCCTCCCGCCGCGCCG"
}
}
}
Simulate Sequencing Reads¶
Generate Illumina paired-end reads from your simulated haplotype:
Prerequisite
Illumina read simulation requires external tools. See Installation: Read Simulation Setup.
# Simulate 30× coverage Illumina reads
muconeup --config config.json reads illumina \
output/mutation_example.001.mut.fa \
--coverage 30 \
--out-base output/reads
Output files:
output/
├── reads_R1.fastq.gz # Forward reads
├── reads_R2.fastq.gz # Reverse reads
├── reads.illumina.bam # Aligned reads
└── reads.illumina.bam.bai # BAM index
Verify Read Simulation¶
# Count reads
zcat output/reads_R1.fastq.gz | wc -l
# Divide by 4 to get number of reads
# Check alignment
samtools view -c output/reads.illumina.bam
# Total aligned reads
# View alignment statistics
samtools flagstat output/reads.illumina.bam
Analyze Open Reading Frames¶
Predict ORFs and detect toxic protein features:
muconeup --config config.json analyze orfs \
output/mutation_example.001.mut.fa \
--out-base output/orfs \
--orf-min-aa 100
Output files:
output/
├── orfs.pep.fa # Predicted peptides (FASTA)
└── orfs.orf_stats.txt # Toxic protein statistics
View ORF Statistics¶
Example output:
Haplotype Statistics:
haplotype_1:
Total ORFs: 12
Toxic ORFs: 3
Longest ORF: 245 aa
Toxic Features:
- ORF 3: overall_score=0.72 (TOXIC)
- ORF 7: overall_score=0.58 (TOXIC)
- ORF 9: overall_score=0.51 (TOXIC)
haplotype_2:
Total ORFs: 10
Toxic ORFs: 0
Learn more: See Toxic Protein Detection for algorithm details.
Complete Workflow Example¶
Putting it all together: simulate, generate reads, analyze:
# 1. Generate diploid haplotype with mutation
muconeup --config config.json simulate \
--mutation-name dupC \
--mutation-targets 1,25 2,30 \
--output-structure \
--out-base output/complete_workflow
# 2. Simulate Illumina reads
muconeup --config config.json reads illumina \
output/complete_workflow.001.simulated.fa \
--coverage 100 \
--out-base output/complete_reads
# 3. Predict ORFs
muconeup --config config.json analyze orfs \
output/complete_workflow.001.simulated.fa \
--out-base output/complete_orfs
# 4. View all outputs
ls -lh output/complete_*
# 5. Examine ground truth
jq '.' output/complete_workflow.001.simulation_stats.json
What you created:
- Diploid reference with known dupC mutations
- Realistic Illumina reads (100× coverage)
- ORF predictions with toxic protein scoring
- Ground truth data for benchmarking
Next steps:
- Run your variant caller on
complete_reads.illumina.bam - Compare variant calls to ground truth in
simulation_stats.json - Evaluate sensitivity and precision
Batch Processing¶
Process multiple samples efficiently:
# Generate 10 samples with varying lengths
for i in {1..10}; do
muconeup --config config.json simulate \
--fixed-lengths $((40 + i * 5)) \
--out-base output/batch_sample_${i}
done
# Simulate reads for all samples (parallel)
ls output/batch_sample_*.simulated.fa | \
parallel muconeup --config config.json reads illumina {} \
--coverage 30 \
--out-base output/reads_{/.}
Common Commands Reference¶
Simulation¶
# Random VNTR lengths (sampled from distribution)
muconeup --config config.json simulate --out-base output/random
# Fixed VNTR lengths
muconeup --config config.json simulate \
--fixed-lengths 60 --out-base output/fixed
# Series generation (parameter sweep)
muconeup --config config.json simulate \
--fixed-lengths 40-80 \
--simulate-series 5 \
--out-base output/series
# Dual simulation (normal + mutated)
muconeup --config config.json simulate \
--mutation-name normal,dupC \
--out-base output/dual
Read Simulation¶
# Illumina paired-end reads
muconeup --config config.json reads illumina \
sample.fa --coverage 100 --out-base reads
# Oxford Nanopore long reads
muconeup --config config.json reads ont \
sample.fa --coverage 50 --out-base reads
# PacBio HiFi reads
muconeup --config config.json reads pacbio \
sample.fa --coverage 30 --out-base reads
Analysis¶
# ORF prediction
muconeup --config config.json analyze orfs \
sample.fa --out-base orfs
# Haplotype statistics
muconeup --config config.json analyze stats sample.fa
# VNTR database analysis
muconeup --config config.json analyze vntr-stats \
database.tsv --header --structure-column vntr
Tips and Best Practices¶
Use Structure Files
Always include --output-structure when generating test data. Structure files provide human-readable repeat chains for validation.
Seed for Reproducibility
Use --seed for reproducible simulations:
Start with Low Coverage
Test workflows with low coverage (10-30×) before running high coverage (100×+) simulations.
Check Configuration
Verify your config.json contains all required sections:
- repeats: Repeat unit sequences
- constants: Left/right flanking regions
- probabilities: State transition probabilities
- length_model: Distribution parameters
Real-World Example
Analyze example VNTR database:
Next Steps¶
Learn More:
- Core Concepts - Understand VNTR simulation fundamentals
- Simulation Guide - Detailed simulation options
- mutations guide (coming soon) - Apply and validate mutations
- read-simulation guide (coming soon) - Platform-specific parameters
Try Workflows:
- Workflows (coming soon) - Verify pipeline sensitivity
- Workflows (coming soon) - Create ML datasets
Getting Help¶
- Documentation: Full Documentation
- Issues: GitHub Issue Tracker
- Examples:
data/examples/directory in repository