SNaPshot Assay Validation¶
In-silico validation of SNaPshot assay for detecting MUC1 VNTR mutations. Simulates complete laboratory workflow: PCR amplification, restriction enzyme digest, single-base extension, and fluorescence detection.
Scientific Background¶
SNaPshot Technology¶
SNaPshot is a multiplexed single-nucleotide polymorphism (SNP) detection method using:
- Single-base extension - Primer anneals adjacent to mutation site
- Fluorescent ddNTPs - Each base (A, C, G, T) labeled with different fluorophore
- Capillary electrophoresis - Detects fluorescent peak at specific size
Clinical Application¶
ADTKD-MUC1 Detection: - Challenge: MUC1 VNTR region (GC-rich repetitive structure) difficult to sequence - Solution: SNaPshot assay selectively detects frameshift mutations - Mechanism: Restriction digest eliminates wild-type, enriches mutant products
Workflow Overview¶
┌─────────────────────────────────────────────────────────────┐
│ SNaPshot Validation Workflow │
└─────────────────────────────────────────────────────────────┘
Input: Genomic DNA template (simulated FASTA)
│
▼
┌──────────────────────────┐
│ Step 1: PCR Amplification│
│ • Forward primer binds │
│ • Reverse primer binds │
│ • Generates amplicon(s) │
│ • Size filter applied │
└────────┬─────────────────┘
│
▼
┌──────────────────────────┐
│ Step 2: Restriction │
│ Digest │
│ • MwoI enzyme recognizes │
│ GCNNNNNNNGC site │
│ • Cuts wild-type products│
│ • Mutant products survive│
└────────┬─────────────────┘
│
▼
┌──────────────────────────┐
│ Step 3: SNaPshot │
│ Extension │
│ • Primer anneals to │
│ surviving amplicons │
│ • ddNTP incorporates │
│ • Fluorophore detected │
└────────┬─────────────────┘
│
▼
┌──────────────────────────┐
│ Output: Mutation Status │
│ • Fluorescence detected │
│ • Mutation type inferred │
│ • Peak size calculated │
└──────────────────────────┘
Step 1: PCR Amplification¶
Purpose¶
Amplify VNTR region containing mutation site using specific primers.
Simulator: PCRSimulator¶
Input: - Template DNA sequence - Forward primer: 5' → 3' - Reverse primer: 5' → 3' (auto reverse-complemented) - Size range filter (min-max bp)
Process:
- Find binding sites for both primers (handles multiple sites)
- Generate amplicons for all valid forward-reverse pairs
- Filter by size (e.g., 300-800 bp)
- Categorize by mutation pattern (mutant/normal/unknown)
- Prioritize mutant products first
Output:
{
"success": true,
"product_count": 3,
"non_specific": true,
"products": [
{
"sequence": "ACGT...TGCA",
"length": 450,
"forward_pos": 1523,
"reverse_pos": 1973,
"flanked_region": "CGT...TGC",
"mutation_type": "mutant"
}
]
}
Implementation: muc_one_up/analysis/snapshot_validator.py:27-181
Step 2: Restriction Digest Selection¶
Purpose¶
Selectively digest products based on presence/absence of restriction site.
Enzyme: MwoI¶
Recognition site: GCNNN|NNNGC (7 bp between GC pairs, cuts in middle)
Mechanism:
Wild-type: GCNNNNNNNGC → Digested (cut into fragments)
Mutant: GC───────GC → Survives (no site due to mutation)
(site disrupted by frameshift)
Simulator: DigestSimulator¶
Input: - List of PCR amplicons - Enzyme specification (e.g., "MwoI")
Process:
- Search for recognition sites in each amplicon (using Bio.Restriction)
- Classify amplicons:
- Has site(s) → Gets digested (destroyed)
- No sites → Survives digest
Output:
{
"total_products": 3,
"digested_count": 2,
"survivor_count": 1,
"survivors": [
{
"sequence": "ACGT...TGCA",
"has_restriction_site": false,
"site_count": 0,
"survives_digest": true,
"mutation_type": "mutant"
}
],
"digested": [...]
}
Key Insight: Frameshift mutations disrupt MwoI recognition site, allowing selective enrichment.
Implementation: muc_one_up/analysis/snapshot_validator.py:183-276
Step 3: SNaPshot Extension¶
Purpose¶
Single-base extension to identify specific mutation nucleotide.
Primer Design¶
Extension primer anneals immediately 5' of mutation site:
Template: 5'-...ACGT[C]GATC...-3' (mutant, C insertion)
↑
Primer: 3'-...TGCA-5'
↓
Extension: ddCTP incorporated
(Black fluorophore)
Simulator: SnapshotExtensionSimulator¶
Input: - Amplicon sequence (from digest survivors) - Primer name (e.g., "primer_7c")
Process:
- Find primer binding site in amplicon
- Identify next base after primer 3' end
- Determine ddNTP that incorporates (complementary to next base)
- Map to fluorophore based on base identity
Fluorophore Mapping:
| Base | ddNTP | Fluorophore | Dye Name | Interpretation |
|---|---|---|---|---|
| C | ddCTP | Black | ddCTP | Mutant pattern (dupC insertion) |
| A | ddATP | Green | ddATP | Incomplete extension or alternate |
| G | ddGTP | Blue | ddGTP | Unexpected (verify sequence) |
| T | ddTTP | Red | ddTTP | Unexpected (verify sequence) |
Output:
{
"binds": true,
"position": 234,
"next_base": "C",
"ddNTP": "ddCTP",
"fluorophore": "Black",
"fluorophore_dye": "ddCTP",
"peak_size": 23,
"interpretation": "Mutant pattern detected (C signal)"
}
Peak size = primer length + 1 (for capillary electrophoresis)
Implementation: muc_one_up/analysis/snapshot_validator.py:279-374
Complete Workflow Orchestration¶
Validator: SnapshotValidator¶
Coordinates all three steps for complete assay simulation.
Input: - Template genomic sequence (FASTA) - Mutation name (e.g., "dupC") - Configuration (primers, enzyme, patterns)
Configuration Structure:
{
"snapshot_validation": {
"dupC": {
"pcr": {
"forward_primer": "ACGTACGTACGT",
"reverse_primer": "TGCATGCATGCA",
"reverse_needs_rc": true,
"max_products": 10,
"size_range": {"min": 300, "max": 800}
},
"digest": {
"enzyme": "MwoI",
"recognition_site": "GCNNNNNNNGC"
},
"snapshot": {
"primers": {
"primer_7c": "GCCACCCCTTCTCCC"
},
"fluorophore_map": {
"C": {"color": "Black", "dye": "ddCTP"},
"A": {"color": "Green", "dye": "ddATP"},
"G": {"color": "Blue", "dye": "ddGTP"},
"T": {"color": "Red", "dye": "ddTTP"}
}
},
"validation": {
"mutant_pattern": "GCCCACGATGTCACCTCAGCC",
"normal_pattern": "GCCCACGGTGTCACCTCGGCC",
"expected_mutant_fluorescence": "Black"
}
}
}
}
Output:
{
"pcr_results": {
"success": true,
"product_count": 3,
"non_specific": true,
"products": [...]
},
"digest_results": {
"survivor_count": 1,
"digested_count": 2,
"survivors": [...]
},
"snapshot_results": [
{
"amplicon": {...},
"extension": {
"next_base": "C",
"fluorophore": "Black",
"peak_size": 23
}
}
],
"mutation_detected": true,
"expected_fluorescence": "Black",
"summary": "dupC mutation DETECTED: 1 survivor(s), fluorescence: Black (ddCTP)"
}
Implementation: muc_one_up/analysis/snapshot_validator.py:377-591
Detailed Flow Diagram¶
┌────────────────────────────────────────────────────────────────────┐
│ SNaPshot Validation │
│ (Component Interaction) │
└────────────────────────────────────────────────────────────────────┘
┌──────────────────────┐
│ Input: Template DNA │
│ (simulated FASTA) │
└───────────┬──────────┘
│
▼
┌──────────────────────┐
│ PCRSimulator │
│ ───────────────── │
│ • _find_binding_sites│
│ (forward primer) │
│ • _find_binding_sites│
│ (reverse primer) │
│ • Generate amplicons │
│ for all F×R pairs │
│ • Filter by size │
│ (min-max bp) │
│ • Categorize by │
│ mutation pattern │
│ • Prioritize mutant │
│ products first │
└───────────┬──────────┘
│
┌─────────────┴─────────────┐
│ PCR Products (List) │
│ [amplicon1, amplicon2, │
│ amplicon3, ...] │
└─────────────┬─────────────┘
│
▼
┌──────────────────────┐
│ DigestSimulator │
│ ───────────────── │
│ • Load enzyme (MwoI) │
│ from Bio.Restriction│
│ • For each amplicon: │
│ - Search for sites │
│ - Has site? → │
│ Digested list │
│ - No site? → │
│ Survivor list │
└───────────┬──────────┘
│
┌─────────────┴─────────────┐
│ Digest Results │
│ • Survivors: [amp1] │
│ • Digested: [amp2, amp3] │
└─────────────┬─────────────┘
│
▼
┌──────────────────────────┐
│ SnapshotExtensionSimulator│
│ ───────────────────── │
│ For each survivor: │
│ • Find primer binding │
│ • Get next base after │
│ primer 3' end │
│ • Determine ddNTP │
│ • Map to fluorophore │
│ (Black/Green/Blue/Red) │
│ • Calculate peak size │
└───────────┬───────────────┘
│
┌─────────────┴─────────────┐
│ Extension Results │
│ [{next_base: "C", │
│ fluorophore: "Black", │
│ peak_size: 23}] │
└─────────────┬─────────────┘
│
▼
┌──────────────────────────┐
│ Mutation Detection Logic│
│ ────────────────────── │
│ • Any survivor shows │
│ "C" (Black)? │
│ → mutation_detected=True│
│ • Else: │
│ → mutation_detected=False│
└───────────┬──────────────┘
│
▼
┌──────────────────────────┐
│ Output: Validation │
│ Report (JSON) │
│ • mutation_detected │
│ • fluorescence colors │
│ • summary string │
└──────────────────────────┘
Usage Examples¶
Command Line¶
# Validate dupC mutation in simulated sample
muconeup --config config.json analyze snapshot-validate \
sample.001.mut.fa \
--mutation dupC \
--output validation_results.json
# Validate on batch of samples
for file in *.mut.fa; do
muconeup --config config.json analyze snapshot-validate \
"$file" --mutation dupC --output "${file%.fa}.validation.json"
done
Python API¶
from Bio import SeqIO
from muc_one_up.analysis.snapshot_validator import SnapshotValidator
from muc_one_up.config import load_config
# Load configuration
config = load_config("config.json")
# Initialize validator for dupC mutation
validator = SnapshotValidator(config, mutation_name="dupC")
# Load template sequence
template_seq = str(SeqIO.read("sample.001.mut.fa", "fasta").seq)
# Run complete validation workflow
results = validator.validate_complete_workflow(template_seq)
# Check results
if results["mutation_detected"]:
print(f"✓ Mutation detected: {results['expected_fluorescence']}")
print(f" Survivors: {results['digest_results']['survivor_count']}")
else:
print(f"✗ No mutation detected")
print(f"\nSummary: {results['summary']}")
Output Interpretation¶
Mutation Detected:
No Mutation:
Biological Mechanism¶
Why Restriction Digest Works¶
Wild-type MUC1 VNTR:
→ Digested by MwoIMutant MUC1 VNTR (dupC frameshift):
5'-GCC[CACGATG]TC-3' ← MwoI site disrupted (extra C shifts frame)
│││││││││
NNNNNNNN (site no longer recognized)
Mutation Types Detected¶
| Mutation | Mechanism | Next Base | Fluorophore |
|---|---|---|---|
| dupC | C insertion | C | Black |
| dupT | T insertion | T | Red |
| delC | C deletion | A | Green |
| Complex | Multiple changes | Variable | Multiple |
Validation and Quality Control¶
Test Cases¶
Implemented in tests/test_snapshot_validator.py:
Test 1: Positive control (dupC mutant)
# Template with dupC mutation → expect detection
template = "...GCCCACGATGTCACCTC..." # mutant pattern
results = validator.validate_complete_workflow(template)
assert results["mutation_detected"] == True
assert results["expected_fluorescence"] == "Black"
Test 2: Negative control (wild-type)
# Template without mutation → expect no detection
template = "...GCCCACGGTGTCACCTC..." # normal pattern
results = validator.validate_complete_workflow(template)
assert results["mutation_detected"] == False
Test 3: Non-specific PCR
# Multiple primer binding sites → prioritize mutant
# Should still detect mutation if any survivor is mutant
Performance Metrics¶
- Sensitivity: Detects mutation if ≥1 mutant survivor
- Specificity: No false positives (wild-type all digested)
- Runtime: < 100 ms per sample
Configuration Guidelines¶
Primer Design¶
Extension primer requirements: - Anneals immediately 5' of mutation site - Length: 15-25 bp (typical) - Tm: 50-60°C - No self-complementarity
PCR primer requirements: - Flank VNTR region - Amplicon size: 300-800 bp (typical for SNaPshot) - Must include mutation site and restriction site
Enzyme Selection¶
MwoI characteristics:
- Recognition: GCNNNNNNNGC
- Cuts in middle: GCNNN|NNNGC
- Thermostable (good for PCR cleanup)
- Common in MUC1 VNTR wild-type
Alternative enzymes:
- Must have recognition site disrupted by mutation
- Use Bio.Restriction to validate
Troubleshooting¶
PCR Failure¶
Symptom: "success": false, "product_count": 0
Causes:
- Primers not in template sequence
- Reverse primer not reverse-complemented (check reverse_needs_rc)
- Size filter too restrictive
Solutions:
# Check primer presence
grep "ACGTACGTACGT" template.fa
# Adjust size range in config
"size_range": {"min": 200, "max": 1000}
All Products Digested¶
Symptom: "survivor_count": 0, "digested_count": 3
Causes: - Mutation not present (wild-type template) - Mutation doesn't disrupt restriction site - Wrong enzyme specified
Solutions:
# Verify mutation pattern in template
grep "GCCCACGATGTCACCTC" template.fa
# Check restriction sites
python -c "from Bio.Restriction import MwoI; from Bio.Seq import Seq; print(MwoI.search(Seq('YOUR_SEQUENCE')))"
No Fluorescence Signal¶
Symptom: "binds": false
Causes: - Extension primer not in amplicon sequence - Primer at very end of amplicon (no base to extend)
Solutions: - Verify primer design - Check amplicon sequence in digest survivors
Implementation Details¶
Module Structure¶
Source: muc_one_up/analysis/snapshot_validator.py
Classes:
- PCRSimulator (lines 27-181) - Amplification with multi-product handling
- DigestSimulator (lines 183-276) - Enzyme digest selection
- SnapshotExtensionSimulator (lines 279-374) - Single-base extension
- SnapshotValidator (lines 377-591) - Workflow orchestrator
Design Principles: - SOLID - Single Responsibility, Dependency Injection - DRY - Configuration-based (no hardcoded values) - Modular - Each component independently testable - Type-safe - Full type hints
Dependencies¶
from Bio.Restriction import Restriction # Enzyme database
from Bio.Seq import Seq # Sequence manipulation
Install:
See Also¶
- mutations guide (coming soon) - Creating mutations for validation
- Configuration Reference - SNaPshot config structure
- API reference (coming soon) - Python API docs
Algorithm Source: muc_one_up/analysis/snapshot_validator.py
Implementation: Lines 1-591
Tests: tests/test_snapshot_validator.py
CLI Integration: muc_one_up/cli/click_main.py:1235-1285