SNaPshot Assay Validation¶

In-silico validation of SNaPshot assay for detecting MUC1 VNTR mutations. Simulates complete laboratory workflow: PCR amplification, restriction enzyme digest, single-base extension, and fluorescence detection.

Scientific Background¶

SNaPshot Technology¶

SNaPshot is a multiplexed single-nucleotide polymorphism (SNP) detection method using:

Single-base extension - Primer anneals adjacent to mutation site
Fluorescent ddNTPs - Each base (A, C, G, T) labeled with different fluorophore
Capillary electrophoresis - Detects fluorescent peak at specific size

Clinical Application¶

ADTKD-MUC1 Detection: - Challenge: MUC1 VNTR region (GC-rich repetitive structure) difficult to sequence - Solution: SNaPshot assay selectively detects frameshift mutations - Mechanism: Restriction digest eliminates wild-type, enriches mutant products

Workflow Overview¶

┌─────────────────────────────────────────────────────────────┐
│               SNaPshot Validation Workflow                  │
└─────────────────────────────────────────────────────────────┘

Input: Genomic DNA template (simulated FASTA)
  │
  ▼
┌──────────────────────────┐
│ Step 1: PCR Amplification│
│ • Forward primer binds   │
│ • Reverse primer binds   │
│ • Generates amplicon(s)  │
│ • Size filter applied    │
└────────┬─────────────────┘
         │
         ▼
┌──────────────────────────┐
│ Step 2: Restriction      │
│         Digest           │
│ • MwoI enzyme recognizes │
│   GCNNNNNNNGC site       │
│ • Cuts wild-type products│
│ • Mutant products survive│
└────────┬─────────────────┘
         │
         ▼
┌──────────────────────────┐
│ Step 3: SNaPshot         │
│         Extension        │
│ • Primer anneals to      │
│   surviving amplicons    │
│ • ddNTP incorporates     │
│ • Fluorophore detected   │
└────────┬─────────────────┘
         │
         ▼
┌──────────────────────────┐
│ Output: Mutation Status  │
│ • Fluorescence detected  │
│ • Mutation type inferred │
│ • Peak size calculated   │
└──────────────────────────┘

Step 1: PCR Amplification¶

Purpose¶

Amplify VNTR region containing mutation site using specific primers.

Simulator: `PCRSimulator`¶

Input: - Template DNA sequence - Forward primer: 5' → 3' - Reverse primer: 5' → 3' (auto reverse-complemented) - Size range filter (min-max bp)

Process:

Find binding sites for both primers (handles multiple sites)
Generate amplicons for all valid forward-reverse pairs
Filter by size (e.g., 300-800 bp)
Categorize by mutation pattern (mutant/normal/unknown)
Prioritize mutant products first

Output:

{
  "success": true,
  "product_count": 3,
  "non_specific": true,
  "products": [
    {
      "sequence": "ACGT...TGCA",
      "length": 450,
      "forward_pos": 1523,
      "reverse_pos": 1973,
      "flanked_region": "CGT...TGC",
      "mutation_type": "mutant"
    }
  ]
}

Implementation: muc_one_up/analysis/snapshot_validator.py:27-181

Step 2: Restriction Digest Selection¶

Purpose¶

Selectively digest products based on presence/absence of restriction site.

Enzyme: MwoI¶

Recognition site: GCNNN|NNNGC (7 bp between GC pairs, cuts in middle)

Mechanism:

Wild-type:  GCNNNNNNNGC → Digested (cut into fragments)
Mutant:     GC───────GC → Survives (no site due to mutation)
            (site disrupted by frameshift)

Simulator: `DigestSimulator`¶

Input: - List of PCR amplicons - Enzyme specification (e.g., "MwoI")

Process:

Search for recognition sites in each amplicon (using Bio.Restriction)
Classify amplicons:
Has site(s) → Gets digested (destroyed)
No sites → Survives digest

Output:

{
  "total_products": 3,
  "digested_count": 2,
  "survivor_count": 1,
  "survivors": [
    {
      "sequence": "ACGT...TGCA",
      "has_restriction_site": false,
      "site_count": 0,
      "survives_digest": true,
      "mutation_type": "mutant"
    }
  ],
  "digested": [...]
}

Key Insight: Frameshift mutations disrupt MwoI recognition site, allowing selective enrichment.

Implementation: muc_one_up/analysis/snapshot_validator.py:183-276

Step 3: SNaPshot Extension¶

Purpose¶

Single-base extension to identify specific mutation nucleotide.

Primer Design¶

Extension primer anneals immediately 5' of mutation site:

Template:  5'-...ACGT[C]GATC...-3'  (mutant, C insertion)
                     ↑
Primer:    3'-...TGCA-5'
                     ↓
Extension:         ddCTP incorporated
                   (Black fluorophore)

Simulator: `SnapshotExtensionSimulator`¶

Input: - Amplicon sequence (from digest survivors) - Primer name (e.g., "primer_7c")

Process:

Find primer binding site in amplicon
Identify next base after primer 3' end
Determine ddNTP that incorporates (complementary to next base)
Map to fluorophore based on base identity

Fluorophore Mapping:

Base	ddNTP	Fluorophore	Dye Name	Interpretation
C	ddCTP	Black	ddCTP	Mutant pattern (dupC insertion)
A	ddATP	Green	ddATP	Incomplete extension or alternate
G	ddGTP	Blue	ddGTP	Unexpected (verify sequence)
T	ddTTP	Red	ddTTP	Unexpected (verify sequence)

Output:

{
  "binds": true,
  "position": 234,
  "next_base": "C",
  "ddNTP": "ddCTP",
  "fluorophore": "Black",
  "fluorophore_dye": "ddCTP",
  "peak_size": 23,
  "interpretation": "Mutant pattern detected (C signal)"
}

Peak size = primer length + 1 (for capillary electrophoresis)

Implementation: muc_one_up/analysis/snapshot_validator.py:279-374

Complete Workflow Orchestration¶

Validator: `SnapshotValidator`¶

Coordinates all three steps for complete assay simulation.

Input: - Template genomic sequence (FASTA) - Mutation name (e.g., "dupC") - Configuration (primers, enzyme, patterns)

Configuration Structure:

{
  "snapshot_validation": {
    "dupC": {
      "pcr": {
        "forward_primer": "ACGTACGTACGT",
        "reverse_primer": "TGCATGCATGCA",
        "reverse_needs_rc": true,
        "max_products": 10,
        "size_range": {"min": 300, "max": 800}
      },
      "digest": {
        "enzyme": "MwoI",
        "recognition_site": "GCNNNNNNNGC"
      },
      "snapshot": {
        "primers": {
          "primer_7c": "GCCACCCCTTCTCCC"
        },
        "fluorophore_map": {
          "C": {"color": "Black", "dye": "ddCTP"},
          "A": {"color": "Green", "dye": "ddATP"},
          "G": {"color": "Blue", "dye": "ddGTP"},
          "T": {"color": "Red", "dye": "ddTTP"}
        }
      },
      "validation": {
        "mutant_pattern": "GCCCACGATGTCACCTCAGCC",
        "normal_pattern": "GCCCACGGTGTCACCTCGGCC",
        "expected_mutant_fluorescence": "Black"
      }
    }
  }
}

Output:

{
  "pcr_results": {
    "success": true,
    "product_count": 3,
    "non_specific": true,
    "products": [...]
  },
  "digest_results": {
    "survivor_count": 1,
    "digested_count": 2,
    "survivors": [...]
  },
  "snapshot_results": [
    {
      "amplicon": {...},
      "extension": {
        "next_base": "C",
        "fluorophore": "Black",
        "peak_size": 23
      }
    }
  ],
  "mutation_detected": true,
  "expected_fluorescence": "Black",
  "summary": "dupC mutation DETECTED: 1 survivor(s), fluorescence: Black (ddCTP)"
}

Implementation: muc_one_up/analysis/snapshot_validator.py:377-591

Detailed Flow Diagram¶

┌────────────────────────────────────────────────────────────────────┐
│                      SNaPshot Validation                           │
│                    (Component Interaction)                         │
└────────────────────────────────────────────────────────────────────┘

                    ┌──────────────────────┐
                    │  Input: Template DNA │
                    │  (simulated FASTA)   │
                    └───────────┬──────────┘
                                │
                                ▼
                    ┌──────────────────────┐
                    │   PCRSimulator       │
                    │ ─────────────────    │
                    │ • _find_binding_sites│
                    │   (forward primer)   │
                    │ • _find_binding_sites│
                    │   (reverse primer)   │
                    │ • Generate amplicons │
                    │   for all F×R pairs  │
                    │ • Filter by size     │
                    │   (min-max bp)       │
                    │ • Categorize by      │
                    │   mutation pattern   │
                    │ • Prioritize mutant  │
                    │   products first     │
                    └───────────┬──────────┘
                                │
                  ┌─────────────┴─────────────┐
                  │  PCR Products (List)      │
                  │  [amplicon1, amplicon2,   │
                  │   amplicon3, ...]         │
                  └─────────────┬─────────────┘
                                │
                                ▼
                    ┌──────────────────────┐
                    │  DigestSimulator     │
                    │ ─────────────────    │
                    │ • Load enzyme (MwoI) │
                    │   from Bio.Restriction│
                    │ • For each amplicon: │
                    │   - Search for sites │
                    │   - Has site? →      │
                    │     Digested list    │
                    │   - No site? →       │
                    │     Survivor list    │
                    └───────────┬──────────┘
                                │
                  ┌─────────────┴─────────────┐
                  │  Digest Results           │
                  │  • Survivors: [amp1]      │
                  │  • Digested: [amp2, amp3] │
                  └─────────────┬─────────────┘
                                │
                                ▼
                    ┌──────────────────────────┐
                    │ SnapshotExtensionSimulator│
                    │ ─────────────────────     │
                    │ For each survivor:        │
                    │ • Find primer binding     │
                    │ • Get next base after     │
                    │   primer 3' end           │
                    │ • Determine ddNTP         │
                    │ • Map to fluorophore      │
                    │   (Black/Green/Blue/Red)  │
                    │ • Calculate peak size     │
                    └───────────┬───────────────┘
                                │
                  ┌─────────────┴─────────────┐
                  │  Extension Results        │
                  │  [{next_base: "C",        │
                  │    fluorophore: "Black",  │
                  │    peak_size: 23}]        │
                  └─────────────┬─────────────┘
                                │
                                ▼
                    ┌──────────────────────────┐
                    │  Mutation Detection Logic│
                    │ ──────────────────────   │
                    │ • Any survivor shows     │
                    │   "C" (Black)?           │
                    │   → mutation_detected=True│
                    │ • Else:                  │
                    │   → mutation_detected=False│
                    └───────────┬──────────────┘
                                │
                                ▼
                    ┌──────────────────────────┐
                    │  Output: Validation      │
                    │  Report (JSON)           │
                    │  • mutation_detected     │
                    │  • fluorescence colors   │
                    │  • summary string        │
                    └──────────────────────────┘

Usage Examples¶

Command Line¶

# Validate dupC mutation in simulated sample
muconeup --config config.json analyze snapshot-validate \
  sample.001.mut.fa \
  --mutation dupC \
  --output validation_results.json

# Validate on batch of samples
for file in *.mut.fa; do
  muconeup --config config.json analyze snapshot-validate \
    "$file" --mutation dupC --output "${file%.fa}.validation.json"
done

Python API¶

from Bio import SeqIO
from muc_one_up.analysis.snapshot_validator import SnapshotValidator
from muc_one_up.config import load_config

# Load configuration
config = load_config("config.json")

# Initialize validator for dupC mutation
validator = SnapshotValidator(config, mutation_name="dupC")

# Load template sequence
template_seq = str(SeqIO.read("sample.001.mut.fa", "fasta").seq)

# Run complete validation workflow
results = validator.validate_complete_workflow(template_seq)

# Check results
if results["mutation_detected"]:
    print(f"✓ Mutation detected: {results['expected_fluorescence']}")
    print(f"  Survivors: {results['digest_results']['survivor_count']}")
else:
    print(f"✗ No mutation detected")

print(f"\nSummary: {results['summary']}")

Output Interpretation¶

Mutation Detected:

dupC mutation DETECTED: 1 survivor(s), fluorescence: Black (ddCTP)

No Mutation:

No dupC mutation detected: all products digested (normal phenotype)

Biological Mechanism¶

Why Restriction Digest Works¶

Wild-type MUC1 VNTR:

5'-GC[CCCACGGT]GC-3'  ← MwoI recognition site intact
      │││││││││
      NNNNNNNN  (7 bases between GC pairs)

→ Digested by MwoI

Mutant MUC1 VNTR (dupC frameshift):

5'-GCC[CACGATG]TC-3'  ← MwoI site disrupted (extra C shifts frame)
       │││││││││
       NNNNNNNN  (site no longer recognized)

→ Survives digest

Mutation Types Detected¶

Mutation	Mechanism	Next Base	Fluorophore
dupC	C insertion	C	Black
dupT	T insertion	T	Red
delC	C deletion	A	Green
Complex	Multiple changes	Variable	Multiple

Validation and Quality Control¶

Test Cases¶

Implemented in tests/test_snapshot_validator.py:

Test 1: Positive control (dupC mutant)

# Template with dupC mutation → expect detection
template = "...GCCCACGATGTCACCTC..."  # mutant pattern
results = validator.validate_complete_workflow(template)
assert results["mutation_detected"] == True
assert results["expected_fluorescence"] == "Black"

Test 2: Negative control (wild-type)

# Template without mutation → expect no detection
template = "...GCCCACGGTGTCACCTC..."  # normal pattern
results = validator.validate_complete_workflow(template)
assert results["mutation_detected"] == False

Test 3: Non-specific PCR

# Multiple primer binding sites → prioritize mutant
# Should still detect mutation if any survivor is mutant

Performance Metrics¶

Sensitivity: Detects mutation if ≥1 mutant survivor
Specificity: No false positives (wild-type all digested)
Runtime: < 100 ms per sample

Configuration Guidelines¶

Primer Design¶

Extension primer requirements: - Anneals immediately 5' of mutation site - Length: 15-25 bp (typical) - Tm: 50-60°C - No self-complementarity

PCR primer requirements: - Flank VNTR region - Amplicon size: 300-800 bp (typical for SNaPshot) - Must include mutation site and restriction site

Enzyme Selection¶

MwoI characteristics: - Recognition: GCNNNNNNNGC - Cuts in middle: GCNNN|NNNGC - Thermostable (good for PCR cleanup) - Common in MUC1 VNTR wild-type

Alternative enzymes: - Must have recognition site disrupted by mutation - Use Bio.Restriction to validate

Troubleshooting¶

PCR Failure¶

Symptom: "success": false, "product_count": 0

Causes: - Primers not in template sequence - Reverse primer not reverse-complemented (check reverse_needs_rc) - Size filter too restrictive

Solutions:

# Check primer presence
grep "ACGTACGTACGT" template.fa

# Adjust size range in config
"size_range": {"min": 200, "max": 1000}

All Products Digested¶

Symptom: "survivor_count": 0, "digested_count": 3

Causes: - Mutation not present (wild-type template) - Mutation doesn't disrupt restriction site - Wrong enzyme specified

Solutions:

# Verify mutation pattern in template
grep "GCCCACGATGTCACCTC" template.fa

# Check restriction sites
python -c "from Bio.Restriction import MwoI; from Bio.Seq import Seq; print(MwoI.search(Seq('YOUR_SEQUENCE')))"

No Fluorescence Signal¶

Symptom: "binds": false

Causes: - Extension primer not in amplicon sequence - Primer at very end of amplicon (no base to extend)

Solutions: - Verify primer design - Check amplicon sequence in digest survivors

Implementation Details¶

Module Structure¶

Source: muc_one_up/analysis/snapshot_validator.py

Classes: - PCRSimulator (lines 27-181) - Amplification with multi-product handling - DigestSimulator (lines 183-276) - Enzyme digest selection - SnapshotExtensionSimulator (lines 279-374) - Single-base extension - SnapshotValidator (lines 377-591) - Workflow orchestrator

Design Principles: - SOLID - Single Responsibility, Dependency Injection - DRY - Configuration-based (no hardcoded values) - Modular - Each component independently testable - Type-safe - Full type hints

Dependencies¶

from Bio.Restriction import Restriction  # Enzyme database
from Bio.Seq import Seq                 # Sequence manipulation

Install:

pip install biopython

SNaPshot Assay Validation¶

Scientific Background¶

SNaPshot Technology¶

Clinical Application¶

Workflow Overview¶

Step 1: PCR Amplification¶

Purpose¶

Simulator: PCRSimulator¶

Step 2: Restriction Digest Selection¶

Purpose¶

Enzyme: MwoI¶

Simulator: DigestSimulator¶

Step 3: SNaPshot Extension¶

Purpose¶

Primer Design¶

Simulator: SnapshotExtensionSimulator¶

Complete Workflow Orchestration¶

Validator: SnapshotValidator¶

Detailed Flow Diagram¶

Usage Examples¶

Command Line¶

Python API¶

Output Interpretation¶

Biological Mechanism¶

Why Restriction Digest Works¶

Mutation Types Detected¶

Validation and Quality Control¶

Test Cases¶

Performance Metrics¶

Configuration Guidelines¶

Primer Design¶

Enzyme Selection¶

Troubleshooting¶

PCR Failure¶

All Products Digested¶

No Fluorescence Signal¶

Implementation Details¶

Module Structure¶

Dependencies¶

See Also¶

Simulator: `PCRSimulator`¶

Simulator: `DigestSimulator`¶

Simulator: `SnapshotExtensionSimulator`¶

Validator: `SnapshotValidator`¶