VNTR Simulation Guide¶
Comprehensive guide to generating MUC1 VNTR diploid haplotypes with MucOneUp.
Overview¶
The simulate command generates diploid haplotype sequences with customizable VNTR structures. It is the core functionality of MucOneUp and the starting point for all workflows.
What it does:
- Generates two haplotype sequences (diploid reference)
- Uses probability-based repeat transitions
- Enforces canonical terminal blocks (6/6p → 7 → 8 → 9)
- Supports fixed or random VNTR lengths
- Applies mutations (optional)
- Integrates SNPs (optional)
- Outputs FASTA, structure files, and JSON statistics
What it does NOT do:
- Simulate sequencing reads (use
muconeup readscommand) - Analyze sequences (use
muconeup analyzecommand)
Following Unix philosophy: one command, one purpose.
Basic Usage¶
Minimal Command¶
Result: Diploid FASTA with random VNTR lengths sampled from distribution in config.json.
Output:
With Structure File¶
Output:
output/
├── sample.001.simulated.fa # FASTA sequences
└── sample.001.vntr_structure.txt # Repeat chain structure
Structure file example:
# Generated: 2025-10-20 15:30:45
# Configuration: config.json
# VNTR Lengths: haplotype_1=65 haplotype_2=58
haplotype_1 1-2-3-4-5-C-X-A-B-X-X-A-B-A-6-7-8-9
haplotype_2 1-2-3-4-5-C-X-B-X-A-X-B-A-6p-7-8-9
With Comprehensive Statistics¶
muconeup --config config.json simulate \
--output-structure \
--output-stats \
--out-base output/sample
Output:
output/
├── sample.001.simulated.fa
├── sample.001.vntr_structure.txt
└── sample.001.simulation_stats.json
Statistics include:
- Haplotype lengths, repeat counts, GC content
- Repeat chain structures
- Mutation details (if applied)
- SNP integration summary
- Runtime metrics
- Configuration snapshot
VNTR Length Control¶
Fixed Lengths¶
Generate haplotypes with exactly N repeats:
# Both haplotypes: 60 repeats
muconeup --config config.json simulate \
--fixed-lengths 60 \
--out-base output/fixed_60
Use cases:
- Controlled experiments
- Benchmarking at specific lengths
- Reproducible test data
Random Lengths (Distribution Sampling)¶
Sample from distribution defined in config.json:
Distribution configured in config.json:
{
"length_model": {
"distribution_type": "normal",
"mean_repeats": 63.3,
"median_repeats": 70,
"min_repeats": 42,
"max_repeats": 85
}
}
Use cases:
- Population-level variation
- Diverse training datasets
- Realistic heterogeneity
Series Generation (Parameter Sweeps)¶
Generate multiple simulations across a length range:
# Generate 5 samples: 40, 50, 60, 70, 80 repeats
muconeup --config config.json simulate \
--fixed-lengths 40-80 \
--simulate-series 5 \
--out-base output/series
Output:
output/
├── series.001.simulated.fa # 40 repeats
├── series.002.simulated.fa # 50 repeats
├── series.003.simulated.fa # 60 repeats
├── series.004.simulated.fa # 70 repeats
└── series.005.simulated.fa # 80 repeats
Progress tracking:
Use cases:
- Length-dependent benchmarking
- Coverage optimization studies
- Algorithm parameter tuning
Reference Assembly Selection¶
Choose human genome assembly (hg19 or hg38):
# Use hg38 (default: hg19)
muconeup --config config.json simulate \
--reference-assembly hg38 \
--out-base output/hg38_sample
Assembly differences:
| Assembly | MUC1 Coordinates | Flanking Regions |
|---|---|---|
| hg19 | chr1:155,158,000-155,165,000 | Left/right constants for GRCh37 |
| hg38 | chr1:155,185,824-155,192,916 | Left/right constants for GRCh38 |
Important: Ensure your reference genome matches the assembly used for simulation.
Structure File Input/Output¶
Generate from Predefined Structure¶
Use existing repeat chains instead of probability-based generation:
# Create structure file
cat > custom_structure.txt << EOF
haplotype_1 1-2-3-X-A-B-X-A-6-7-8-9
haplotype_2 1-2-X-A-X-B-A-X-6p-7-8-9
EOF
# Generate sequences from structure
muconeup --config config.json simulate \
--input-structure custom_structure.txt \
--out-base output/from_structure
Use cases:
- Reproduce published VNTR structures
- Test specific repeat compositions
- Validate mutation application on known structures
Structure File Format¶
Header:
Body:
haplotype_1 <repeat1>-<repeat2>-<repeat3>-...-<terminal_block>
haplotype_2 <repeat1>-<repeat2>-<repeat3>-...-<terminal_block>
Rules:
- Dash-separated repeat symbols
- Must end with terminal block (6 or 6p, then 7, 8, 9)
- Symbols must be defined in
config.json - Mutation markers (
msuffix) added automatically when mutations applied
Probability-Based Generation¶
How It Works¶
- Start with initial repeat (e.g.,
1) - Sample next repeat from probability distribution
- Append to chain
- Repeat until target length reached
- Enforce terminal block
Probability Matrix¶
Defined in config.json:
{
"probabilities": {
"1": {"2": 0.3, "3": 0.2, "X": 0.5},
"2": {"1": 0.2, "3": 0.3, "A": 0.5},
"X": {"A": 0.4, "B": 0.4, "X": 0.2},
"A": {"B": 0.5, "X": 0.3, "A": 0.2},
"B": {"A": 0.4, "X": 0.4, "B": 0.2}
}
}
Example transition:
From repeat 1, next repeat sampled:
- 2 with 30% probability
- 3 with 20% probability
- X with 50% probability
Customizing Probabilities¶
Update config.json to match real-world VNTR structures:
# Analyze existing VNTR database
muconeup --config config.json analyze vntr-stats \
data/examples/vntr_database.tsv \
--header \
-o observed_probs.json
# Extract transition probabilities
jq '.transition_probabilities' observed_probs.json
# Update config.json with observed probabilities
Output Options¶
Output Directory¶
Specify where files are saved:
Default: Current working directory
Output Base Name¶
Prefix for all output files:
Output:
my_simulation.001.simulated.fa
my_simulation.001.vntr_structure.txt
my_simulation.001.simulation_stats.json
Verbose Logging¶
Enable detailed logging:
Alternative:
Mutation Application¶
Dual Simulation Mode¶
Generate normal and mutated pairs:
muconeup --config config.json simulate \
--mutation-name normal,dupC \
--mutation-targets 1,25 \
--out-base output/dual
Output:
output/
├── dual.001.normal.fa # Normal diploid
├── dual.001.normal.vntr_structure.txt
├── dual.001.normal.simulation_stats.json
├── dual.001.mut.fa # Mutated diploid
├── dual.001.mut.vntr_structure.txt
└── dual.001.mut.simulation_stats.json
Use case: Benchmarking variant callers (known ground truth).
Targeted Mutations¶
Specify exact positions:
muconeup --config config.json simulate \
--mutation-name dupC \
--mutation-targets 1,25 2,30 \
--output-structure \
--out-base output/targeted
Mutation applied:
- Haplotype 1, repeat position 25
- Haplotype 2, repeat position 30
Structure file shows markers:
# Mutation Applied: dupC (Targets: [(1, 25), (2, 30)])
haplotype_1 1-2-3-...-Xm-...-6-7-8-9
haplotype_2 1-2-3-...-Am-...-6p-7-8-9
The m suffix indicates mutated positions.
Random Mutations¶
Let MucOneUp select positions:
muconeup --config config.json simulate \
--mutation-name dupC \
--random-mutation-targets 3 \
--out-base output/random_mut
Behavior:
- Selects 3 random positions
- Respects
allowed_repeatsconstraint (only mutates valid repeat types) - Records positions in
simulation_stats.json
SNP Integration¶
Random SNPs¶
Generate random single nucleotide polymorphisms:
muconeup --config config.json simulate \
--random-snps \
--random-snp-density 1.0 \
--out-base output/with_snps
Density: SNPs per 1000 bp (1.0 = ~1 SNP per kb)
File-Based SNPs¶
Apply SNPs from TSV file:
# Create SNP file (TSV format)
cat > snps.tsv << EOF
haplotype position ref alt
1 150 A G
1 350 C T
2 200 G A
EOF
# Apply SNPs
muconeup --config config.json simulate \
--snp-input-file snps.tsv \
--out-base output/snp_file
File format:
- haplotype: 1 or 2 (1-indexed)
- position: 0-indexed position in final sequence
- ref: Reference base (validated before application)
- alt: Alternate base
Reproducibility¶
Seed-Based Generation¶
Ensure reproducible outputs:
# Run 1
muconeup --config config.json simulate \
--seed 42 \
--out-base run1
# Run 2 (identical to run 1)
muconeup --config config.json simulate \
--seed 42 \
--out-base run2
# Verify
diff run1.001.simulated.fa run2.001.simulated.fa
# Files are identical
Guarantees:
- Same seed → identical repeat chains
- Same seed → identical random SNPs
- Platform-independent (Linux/macOS/Windows)
Requirements:
- Identical
config.json - Same MucOneUp version
- Same Python version (3.10+)
Provenance Metadata¶
When using --output-stats, MucOneUp automatically records provenance metadata in *.simulation_stats.json:
{
"provenance": {
"software_version": "0.27.0",
"config_fingerprint": "sha256:aed09353ff7...",
"seed": 42,
"start_time": "2025-11-03T11:48:44.249499+00:00",
"end_time": "2025-11-03T11:48:44.256557+00:00",
"duration_seconds": 0.007058,
"command_line": "muconeup --config config.json simulate --seed 42"
}
}
Config Fingerprints:
Configuration fingerprints use RFC 8785 JSON canonicalization—identical configs produce identical SHA-256 hashes across platforms. System paths (human_reference, tool paths) are excluded to ensure portability.
Command-Line Sanitization:
Secret patterns (--api-key, --password, --token, etc.) are automatically redacted as ***REDACTED*** to prevent credential leakage in published datasets.
Disable Provenance:
Advanced Options¶
Custom Configuration File¶
Use non-default configuration:
Logging Levels¶
Control verbosity:
# Minimal output
muconeup --log-level ERROR --config config.json simulate \
--out-base output/sample
# Detailed debug output
muconeup --log-level DEBUG --config config.json simulate \
--out-base output/sample
# No logging
muconeup --log-level NONE --config config.json simulate \
--out-base output/sample
Levels: DEBUG, INFO, WARNING, ERROR, CRITICAL, NONE
Common Workflows¶
Benchmark Variant Caller¶
# Generate ground truth
muconeup --config config.json simulate \
--mutation-name normal,dupC \
--mutation-targets 1,25 \
--fixed-lengths 60 \
--output-structure \
--out-base benchmark
# Simulate reads (separate command)
muconeup --config config.json reads illumina \
benchmark.001.mut.fa --coverage 100
Generate Training Dataset¶
# Generate 100 samples with varying lengths
for i in {1..100}; do
muconeup --config config.json simulate \
--seed ${i} \
--out-base training/sample_${i}
done
Test Mutation Detection¶
# Apply targeted mutation
muconeup --config config.json simulate \
--mutation-name dupC \
--mutation-targets 1,25 2,30 \
--output-structure \
--out-base mutation_test
# Check ground truth
jq '.mutations' mutation_test.001.simulation_stats.json
Troubleshooting¶
Issue: Invalid Repeat Symbol¶
Error:
Solution:
Ensure all repeat symbols in structure file or mutations are defined in config.json:
{
"repeats": {
"1": "AAGGAGACTTCGGCTACCCAGAGAAGTTCAGTGCCCAGCTCTACTGAGAAGAATGCTGTG",
"2": "AGTATGACCAGCAGCGTACTCTCCAGCCACAGCCCCGGTTCAGGCTCCTCCACCACTCAG",
"Z": "SEQUENCE_FOR_Z"
}
}
Issue: Terminal Block Missing¶
Error:
Solution:
When using --input-structure, ensure chains end with terminal block:
# Correct
haplotype_1 1-2-3-X-A-B-6-7-8-9
# Incorrect (missing terminal block)
haplotype_1 1-2-3-X-A-B
Issue: Mutation Target Invalid¶
Error:
Solution:
Mutation positions must be within VNTR length:
# Haplotype has 60 repeats, so position must be ≤60
muconeup --config config.json simulate \
--fixed-lengths 60 \
--mutation-targets 1,25 # Valid (25 ≤ 60)
Next Steps¶
Learn More:
- mutations guide (coming soon) - Apply and validate mutations
- snps guide (coming soon) - Advanced SNP workflows
- Configuration Reference - Customize repeat definitions
Try Workflows:
- Workflows (coming soon)
- Workflows (coming soon)
Command Reference¶
muconeup --config CONFIG simulate [OPTIONS]
Required:
--out-base TEXT Output filename base
VNTR Length:
--fixed-lengths INT|RANGE Fixed repeat count (e.g., 60 or 40-80)
--simulate-series INT Number of iterations for series
Mutations:
--mutation-name TEXT Mutation name (or "normal,name" for dual)
--mutation-targets TEXT Targets as "hap,pos" (e.g., "1,25 2,30")
--random-mutation-targets INT Random target count
SNPs:
--random-snps Generate random SNPs
--random-snp-density FLOAT SNPs per 1000 bp (default: 1.0)
--snp-input-file PATH TSV file with SNPs
Structure:
--input-structure PATH Input structure file
--output-structure Output structure file
Assembly:
--reference-assembly TEXT hg19 or hg38 (default: hg19)
Output:
--out-dir PATH Output directory (default: .)
--output-stats Output simulation statistics JSON
Reproducibility:
--seed INT Random seed for reproducibility
Logging:
--log-level LEVEL DEBUG|INFO|WARNING|ERROR|CRITICAL|NONE
--verbose, -v Enable verbose output
See Also¶
- API reference (coming soon) - Python API for programmatic use
- Core Concepts - Understanding VNTR simulation